Skip to main content

Advertisement

Table 2 Sequences of primers used in the real-time quantitative PCR

From: Antiangiogenic effects of oridonin

Gene name Sequence of primers
Claudin 1 Forward CGATATTTCTTCTTGCAGGTCTGG
  Reverse CAAATTCGTACCTGGCATTGACT
Claudin 2 Forward CCAGAGAAATCGCTCCAACTACT
  Reverse GGCTGTAGGAATTGAACTCACTCTT
Claudin 3 Forward CCAACACCATTATCCGGGACTTC
  Reverse TAGACGTAGTCCTTGCGGTCGTA
Claudin 4 Forward AACATTGTCACCTCGCAGAC
  Reverse CAGGACACCGGCACTATCAC
Claudin 5 Forward TGATTGGCTGCGGCACGATGAC
  Reverse GCCCGCACGCCAGGATCAGAC
Claudin 6 Forward CTGACGCTAATCCCCGTGTG
  Reverse CCATTCCCCTCCACGTCAGA
Claudin 7 Forward ATGAGCTGCAAAATGTACGACT
  Reverse GCCATACCAGGAGCAAGCTAC
Claudin 8 Forward GGCCTTCATTGAAAACAACATC
  Reverse TGAAAGCCAAGAAGGACATCAC
Claudin 9 Forward TTCGACCGGCTTAGAACTGCT
  Reverse GTGAGTCGTACACCTTGCACT
Claudin 12 Forward ACTGCCTGATGTACGACACTA
  Reverse AAAAGACTGGCTCAAACTTCT
Claudin 18 Forward CATCTTTGCCCTGAAATGCATC
  Reverse ATTACACATAGTCGTGCTTGGA
β-Actin Forward CACCCAGCACAATGAAGATCAAG
  Reverse TGTCAAGAAAGGGTGTAACGCAACT