Skip to main content

Advertisement

Table 1 Sequences of primers used in the RT-PCR

From: Antiangiogenic effects of oridonin

Gene name Sequence of primers
VEGFA Forward CAGCTGTCAAGAGTGCCTACATAC Reverse CATCAGGGTACTCCTGCTGAATTTC
VEGFR2 Forward TCACATGGTTTGGTAGAGGGATCTC Reverse GTGCAGTTGATCCTCTGCAAATGAG
VEGFR3 Forward TCTGTCGGATTTGGATTGGGA Reverse TTGGTGTTGTCAAGGGTGGG
TP53 Forward CTTGCCCCGTTCAAATGGTG Reverse TAGATGGCAGTGGCTCGAAC
β-Actin Forward CGAGCAGGAGATGGGAACC Reverse CAACGGAAACGCTCATTGC