Skip to main content

Advertisement

Table 1 Nucleotide sequences of primers used in real-time PCR

From: Effect of DanQi Pill on PPARα, lipid disorders and arachidonic acid pathway in rat model of coronary heart disease

Gene (accession no.) Primes Nucleotiede sequences5‘-3’ Length (bp) Temp (°C)
LPL Forward CGCTCCATCCATCTCTTC   57.3
Reverse GGCTCTGACCTTGTTGAT 159 55.0
CD36 Forward GGTCCTTACACATACAGAGT   55.8
Reverse CCACAGCCAGATTGAGAA 163 55.0
GAPDH Forward TCAACGGCACAGTCAAG   55.0
Reverse TACTCAGCACCAGCATCA 116 55.0