Skip to main content

Advertisement

Table 1 Names, accession number and primer sequences used in the study

From: Effects of phenolic-rich extracts of Clinacanthus nutans on high fat and high cholesterol diet-induced insulin resistance

Gene name   Primer sequence (with universal tag)  
   Forward primer Reverse primer
AdiponectinR2 NM_001037979 AGGTGACACTATAGAATACACTCCTGGAGAGAAGG GTACGACTCACTATAGGGACTGAATGCTGAGTGATACAT
IRS NM_017071 AGGTGACACTATAGAATAAGCTGGAGGAGTCTTCAT GTACGACTCACTATAGGGAAAGGGATCTTCGCTTT
Pik3 NM_133399 AGGTGACACTATAGAATACAAGGATCTGACTTATTTCC GTACGACTCACTATAGGGACTAACCATGCTGTTACCAA
LeptinR NM_012596 AGGTGACACTATAGAATACAAAGTCCAGGATGACAC GTACGACTCACTATAGGGACTTGGACAAACTCAGAATG
PPIA a NM_017101 AGGTGACACTATAGAATATTCTGTAGCTCAGGAGAGCA GTACGACTCACTATAGGGATTGAAGGGGAATGAGGAAAA
GAPDHa, b NM_017008 A GGTGACACTATAGAATAATGACTCTACCCACGGCAAG GTACGACTCACTATAGGGAAGCATCACCCCATTTGATGT
KanR c    
  1. a House Keeping gene, b Normalized gene, c Internal control
  2. Reverse transcription (RT) and PCR were done according to manufacturer’s instructions; RT reaction was at 48 °C for 1 min; 37 °C for 5 min; 42 °C for 60 min; 95 °C for 5 min, then hold at 4 °C, while PCR was as follows: initial denaturation at 95 °C for 10 min, followed by two-step cycles of 94 °C for 30 s and 55 °C for 30 s, ending in a single extension cycle of 68 °C for 1 min