Skip to main content

Advertisement

Table 1 Sequences of qPCR primers used in this study

From: Icariin protects rats against 5/6 nephrectomy-induced chronic kidney failure by increasing the number of renal stem cells

Gene Primer sequences Amplicon (bp)
TGF-β1 GAAGGACCTGGGTTGGAAG 136
CGGGTTGTGTTGGTTGTAG
HGF CCTATTTCCCGTTGTGAAG 138
ACTAACCATCCACCCTACT
BMP-7 ACTACTGTGAGGGAGAGTG 97
TCTGGGTTGATGAAGTGAA
Wt1 AAAAGTGGCTCACAGTGTC 139
ATGGAACAACCGCTCTAAT
Pax-2 CTGGGCAGGTACTACGAGA 190
CGCTGGGAACTGTATCATT
CD24 CCAGCCACCCCTGAGTAAATC 90
GAACTTAGTACCCGTGGTGAGTGA
CD133 ACGGAAGTCAGCTCCCATCA 76
GGCTCTCCAGATCGGTTCTG
Osr1 TTCTAAAGTGCCAGGTGCGG 79
GACGTGTGGAAACCAGGGAA
Nanog TGCTCCGCTCCATAACTTCG 100
AGTGGCTTCCAAATTCGCCT
β-actin CTCACTGTCCACCTTCCAGC 121
AAGGGTGTAAAACGCAGCTCA