Skip to main content

Advertisement

Table 1 Sequences of the RT-PCR primers

From: Effects of Ixeris dentata water extract and caffeic acid on allergic inflammation in vivo and in vitro

Genes Forward (5’-3’) Reverse (5’-3’)
IL-8 GTCCTTGTTCCACTGTGCCT GCTTCCACATGTCCTCACAA
TARC ACTGCTCCAGGGATGCCATCGTTTTT ACAAGGGGATGGGATCTCCCTCACTG
MDC AGGACAGAGCATGGCTCGCCTACAGA TAATGGCAGGGAGGTAGGGCTCCTGA
ICAM-1 CACCCTAGAGCCAAGGTGAC CATTGGAGTCTGCTGGGAAT
MMP-9 CACTGTCCACCCCTCAGAGC GCCACTTGTCGGCGATAAGG
β-actin GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG