Skip to main content

Advertisement

Table 1 Primers used in real-time PCR

From: Electroacupuncture inhibits weight gain in diet-induced obese rats by activating hypothalamicLKB1-AMPK signaling

Gene Primer sequence Gene number Product length
LKB1 F GGCTCTTGTGCCTATCCC NM001108069.1 201 bp
LKB1 R CCATTCTGACCCACTTCCTC NM001108069.1 201 bp
ACC F CGGCAACAAACAAGGG NM053922.1 260 bp
ACC R CGTTACAACCAGGAAGCC NM053922.1 260 bp
AMPKα1 F CCTACCACCTCATAATAGACAA NM019142.2 348 bp
AMPKα1 R GGTTCTTCCTTCGCACA NM019142.2 348 bp
AMPKα2 F CTGAGAAGCAGAAGCACGAC NM023991.1 537 bp
AMPKα2 R CTGCATAATTTGGCGATCC NM023991.1 537 bp
GAPDH F CAGTGCCAGCCTCGTCTCAT NM017008.4 595 bp
GAPDH R AGGGGCCATCCACAGTCTTC NM017008.4 595 bp