Skip to main content

Advertisement

Table 2 Primers sequence of GAPDH, M3 receptors and TRPV1

From: Effects of Radix Linderae extracts on a mouse model of diabetic bladder dysfunction in later decompensated phase

Gene Primer(5′-3′)
GAPDH - F TGAAGCAGGCATCTGAGGG
GAPDH - R CGAAGGTGGAAGAGTGGGAG
M 3 - F AGCGCCTTCTGTCTGCTTTTG
M 3 - R CAGCCCTCTCTGATCTCGCC
TRPV1 - F CAAGGCTCTATGATCGCAGG
TRPV1 - R GAGCAATGGTGTCGTTCTGC