Skip to main content

Advertisement

Table 1 The primers sequence involved in the paper

From: The traditional Chinese formulae Ling-gui-zhu-gan decoction alleviated non-alcoholic fatty liver disease via inhibiting PPP1R3C mediated molecules

gene forward reverse
PPP1R3C 5’-ATTTGCTTGGCACATTCACC-3’ 5′- GTGGGCTCTTCCATTCCTTC-3’
SLC38A2 5’-CAGTTGGGACATAAGGCATACG-3’ 5’-ATAGTCGCCGTTCAGATACCAC-3’
OSGIN1 5′- GCAGCAGATGATGCGTGAC -3’ 5′- GGAGCCGATGAGGACGAG − 3’
ZFP189 5′- GAAAGACATCGAACCACAGGG − 3’ 5’-TGTTCCTCAGTCAAAGAATCACG-3’
β-actin 5’-CCCATCTATGAGGGTTACGC-3’ 5’-TTTAATGTCACGCACGATTTC-3’