Skip to main content

Advertisement

Table 2 Primer sequences of genes analyzed in real time PCR

From: Probiotics and yogurt modulate oxidative stress and fibrosis in livers of Schistosoma mansoni-infected mice

Name Accession number Sense (5′---3′) Antisense (5′---3′)
β-actin NM_031144.3 GGCATCCTGACCCTGAAGTA GGGGTGTTGAAGGTCTCAAA
SOD2 NM_001270850.1 AGCTGCACCACAGCAAGCAC TCCACCACCCTTAGGGCTCA
CAT NM_012520.2 TCCGGGATCTTTTTAACGCCATTG TCGAGCACGGTAGGGACAGTTCAC
GPx1 NM_017006.2 CGGTTTCCCGTGCAATCAGT ACACCGGGGACCAAATGATG
Bcl-2 NM_016993.1 CTGGTGGACAACATCGCTCTG GGTCTGCTGACCTCACTTGTG
Bax NM_017059.2 GGCGAATTGGCGATGAACTG ATGGTTCTGATCAGCTCGGG
  1. The abbreviations of the genes; SOD2 Manganese-dependent superoxide dismutase (MnSOD), CAT Catalase, GPx Glutathione peroxidase, Bcl-2 B-cell lymphoma 2, Bax Bcl-2-like protein 4