Skip to main content

Advertisement

Table 1 Assay ID of the inventory primers and probes and the sequence of the self-designed primers used for qRT-PCR

From: Electric stimulation of ears accelerates body weight loss mediated by high-fat to low-fat diet switch accompanied by increased white adipose tissue browning in C57BL/6 J mice

Gene Accession number Assay ID or primer sequence
Ucp1 NM_009463.3 Mm01244861_m1
Npy NM_023456.3 F: CAGAACAAGGCTTGAAGACC C R: GCAGACTGGTTTCAGGGGAT
AgRP NM_007427.3 F: GAGTTCCCAGGTCTAAGTCTGAATG R: ATCTAGCACCTCCGCCAAAG
Pomc NM_008895 F: CCCGCCCAAGGACAAGCGTT R: CTGGGCCCTTCTTGTGCGCGT
  1. 1Inventory primers and probes purchased from Applied Biosystems