Skip to main content

Advertisement

Table 1 Primers used for real-time PCR

From: Acanthus ebracteatus leaf extract provides neuronal cell protection against oxidative stress injury induced by glutamate

Gene Accession number Sequence (5' → 3') Product length (bp)
EAAT3 NM_009199.2 Forward: ATGATCTCGTCCAGTTCGGC 202
Reverse: TGACGATCTGCCCAATGCTT
NQO1 NM_008706.5 Forward: CGACAACGGTCCTTTCCAGA 253
Reverse: CTCCCAGACGGTTTCCAGAC
GCLM NM_008129.4 Forward: GGAGCTTCGGGACTGTATCC 236
Reverse: CAACTCCAAGGACGGAGCAT
ACTB NM_007393.5 Forward: GGCTGTATTCCCCTCCATCG 154
Reverse: CCAGTTGGTAACAATGCCATGT