Skip to main content

Advertisement

Table 1 Primer sequence used for quantitative Real Time PCR analysis

From: Water/ethanol extract of Cucumis sativus L. fruit attenuates lipopolysaccharide-induced inflammatory response in endothelial cells

Genes Forward (5′-3′) Reverse (5′-3′) Product size (bp) Accession Number
HPRT GGACAGGACTGAACGGCTTG GTAATCCAGCAGGTCAGCAAAG 115 AF143818
HO-1 CGCTCCCGAATGAACAC GCTCCTGCACCTCCTC 112 NM_001004027
TLR4 CAGATACAGAGGGTCATGCTTTC GGGGATGTTGTCAGGGATTTG 215 NM_001113039.1
ZO-1 AGTGCCGCCTCCTGAGTTTG CATCCTCATCTTCATCATCTTCTACAG 147 AJ318101