Skip to main content

Advertisement

Table 1 The gene-specific primers used in this study

From: The ameliorative effect of bloodletting puncture at hand twelve Jing-well points on cerebral edema induced by permanent middle cerebral ischemia via protecting the tight junctions of the blood-brain barrier

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′) Product size
Occludin CCGCCAAGGTTCGCTTATCT TTCAAAAGGCCTCACGGACA 96
Claudin-5 TATGAATCTGTGCTGGCGCT AGTGCTACCCGTGCCTTAAC 158
ICAM-1 TGTCAGCCACCATGCCTTAG CAGCTTGCACGACCCTTCTA 132
VEGF-α ATGCGGATCAAACCTCACCA AAACCGGGATTTCTTGCGCT 162
GAPDH AAGAGGGATGCTGCCCTTAC TACGGCCAAATCCGTTCACA 119