Skip to main content

Advertisement

Table 1 Primers applied in the experiments

From: Formula PSORI-CM01 eliminates psoriasis by inhibiting the expression of keratinocyte cyclin B2

gene primer (F/R) bp
CCNB1 TCTGGATAATGGTGAATGGACA; CGATGTGGCATACTTGTTCTTG 157
CCNA2 AGCTGCCTTTCATTTAGCACTCTAC; TTAAGACTTTCCAGGGTATATCCAGTC 93
CCNB2 TTGCAGTCCATAAACCCACA; GAAGCCAAGAGCAGAGCAGT 218
CCNB3 GAACCAGCCCAAATGTGTCT; ACAACTCCTTCCCAGTGGTG 162
TGFb1 AGGGCTACCATGCCAACTTC; CCCGGGTTATGCTGGTTGTA 103
GAPDH GGTCTCCTCTGACTTCAACA; AGCCAAATTCGTTGTCATAC 116