Skip to main content

Advertisement

Table 1 PCR sequences and PCR products

From: Effect of astragalus injection on renal tubular epithelial transdifferentiation in type 2 diabetic mice

Name Size Forward Primer (5′–3′) Reverse Primer (5′–3′)
TGF-β1 493 bp TCCCTCAACCTCAAATTATTCA GCGGTCCACCATTAGCAC
TGFβ-R1 172 bp GGCGAAGGCATTACAGTGTT TGCACATACAAATGGCCTGT
α-SMA 322 bp GGTGCTGTCTCTCTATGCCTCTGGA CCCATCAGGCAACTCGATACTCTTC
E-cadherin 192 bp AGACAGGGGTGGAGGAAGTT GGGCAGGAGTCTAGCAGAAG
β-actin 243 bp GAAATCGTGCGTGACATTAAGG CACGTCACACTTCATGATGGAG