Skip to main content

Advertisement

Table 1 The primer characteristics used for the gene expression analysis

From: Cytoprotective effect of palm kernel cake phenolics against aflatoxin B1-induced cell damage and its underlying mechanism of action

Genes   Sequences (5′ to 3′) References
NF-kB F gaaggaatcgtaccgggaaca [39]
R ctcagagggccttgtgacagtaa
iNOS F gaacagccagctcatccgata [40]
R cccaagctcaatgcacaactt
TNF-α F tgtgtatgtgcagcaacccgtagt [2]
R ggcattgcaatttggacagaagt
IL1ß F tgggcatcaagggctaca [41]
R tcgggttggttggtgatg
IL6 F caaggtgacggaggaggac [41]
R tggcgaggagggatttct
Bax F tcctcatcgccatgctcat [42]
R ccttggtctggaagcagaaga
Bcl2 F gatgaccgagtacctgaacc [42]
R caggagaaatcgaacaaaggc
GAPDH F gtcagcaatgcatcgtgca [40]
R ggcatggacagtggtcataaga
β-Actin F acacggtattgtcaccaact [41]
R taacaccatcaccagagtcc