Skip to main content

Advertisement

Table 1 Sequences of the primers for the real-time RT-PCR test

From: Cognitive improvement of compound danshen in an Aβ25-35 peptide-induced rat model of Alzheimer’s disease

Primer Sequence Tm (°C)
β-Actin F: 5’ AGAGGGAAATCGTGCGTGAC 3’ 58
R: 5’CCATACCCAGGAAGGA AGGCT 3’
APP F: 5’ AGAGGTCTACCCTGAACTGC 3’ 61
R: 5’ ATCGCTTACAAACTCACCAACT 3’
BACE1 F: 5’ CGGGAGTGGTATTATGAAGTG 3’ 57
R: 5’AGGATGGTGATGCGGAAG 3’
PS1 F: 5’ TGAGGAGGAAGACGAAGA 3’ 60
R: 5’ CACGGCGACATTGTAGGA 3’
IDE F: 5’ AGTCAAAGGGCTGGGTAA 3’ 58
R: 5’ TCTATCAAGTCGGGTCTAA 3’
NEP F: 5’ GAAGACCGAAATGACCCA 3’ 58
R: 5’ CGGATGTAGTCCCGTAAA 3’