Skip to main content

Advertisement

Table 1 Nucleotide sequence of PCR primers for amplification and sequence-specific detection of cDNA (obtained from GenBank database)

From: Water extract of brewers’ rice induces apoptosis in human colorectal cancer cells via activation of caspase-3 and caspase-8 and downregulates the Wnt/β-catenin downstream signaling pathway in brewers’ rice-treated rats with azoxymethane-induced colon carcinogenesis

Primer name [accession number] Oligonucleotides (5′-3′)
Sequence
AXIN1 [XM_005255610.2] F- TTTCACCGAAGATGCTCCCC
R- CACTGCCCTCAGGCTCATAC
CK1 [NM_001271741.1] F- GAGATCCCTTTCCCAGAGTGC
R- TTTGTGAAGGGCTTCTCGGC
GSK3β [BC012760] F- CGAATGGGGAACAGTCGAGG
R- TCGGAAATGCGACGGGAAAC
APC [NM_000038.5] F- AGCAAGTTGAGGCACTGAAGA
R- TCCCGGCTTCCATAAGAACG
LRP6 [NM_002336.2] F- ACATGACAGGTCGAGAGGGT
R- CCAAGCCACAGGGATACAGT
ACTBa [NM_001101.3] F- AGAGCTACGAGCTGCCTGAC
R- AGCACTGTGTTGGCGTACAG
GAPDHa [NM_002046.4] F- GGATTTGGTCGTATTGGGC
R- TGGAAGATGGTGATGGGATT
18S rRNAa [HQ387008.1] F- GTAACCCGTTGAACCCCATT
R-CCATCCAATCGGTAGTAGCG
  1. ACTB- beta-actin, APC- adenomatous polyposis coli, CK1- casein kinase 1, GAPDH- glyceraldehyde-3-phosphate dehydrogenase, GSK3β- glycogen synthase kinase 3β, LRP6- low density lipoprotein receptor-related protein 6
  2. aHousekeeping gene