Skip to main content

Advertisement

Table 2 Four primers used for HRM analysis and identification

From: Fast and reliable detection of toxic Crotalaria spectabilis Roth. in Thunbergia laurifolia Lindl. herbal products using DNA barcoding coupled with HRM analysis

Primer name Nucleotide sequence (5’ to 3’) Ta (°C) Expected size (bp)
matK _F CTTCTTATTTACGATTAACATCTTCT 57 160
matK _R TTTCCTTGATATCGAACATAATG   
rbcL_F GGTACATGGACAACTGTGTGGA 57 150
rbcL _R ACAGAACCTTCTTCAAAAAGGTCTA   
rpoC_F CCSATTGTATGGGAAATACTT 57 170
rpoC _R CTTACAAACTAATGGATGTAA   
trnL_F GAATCGACCGTTCAAGTATCC 57 150
trnL _R TATAGGAAACCCATATTTGATCCAATC