Skip to main content

Advertisement

Table 1 Sequences of primer for quantitative RT-PCR of several genes

From: Antifungal activity of berberine hydrochloride and palmatine hydrochloride against Microsporum canis -induced dermatitis in rabbits and underlying mechanism

Gene symbol Primer Primer sequence, 5’ → 3’
PGAL4 F ATGCGCATTGTCCTCAACAG
  R GGGTGGCCCCAACCA
FSH1 F TGCTGAGAAGAGACAGGCAAAC
  R GCTGTCATATTTCTACCGACAACAA
PQ-LRP F CCCCCCAGATCATTGAAAACT
  R CAGACGACGAGGAATTCTAATGATAG
NADH1 F CCTGCTTTACTTATAGTAGCTTTTGTTACAA
  R AAATGCTTGGAGTAAACCATAATAACC
RNP F GTCCAGGAACTCTTCTCCAAGCACG
  R GCCACCAAGGTCAGCACCGTATT
NDR F TCGAGTTCTGATCGCATGGC
  R TCGCGGACTGAGAGAGTTCA
SC F CTACAGTGGGATACGACCGAGC
  R TTCCCACCGCGACTGCA
ZTZ F CTACCTTACTCGGGCTGGTTACT
  R TGGTGTGCTGCTATGCTGAT
18S F TGGTGCATGGCCGTTCTTA
  R GGTCTCGTTCGTTATCGCAATT