Skip to main content

Advertisement

Table 1 Primers for real-time-PCR

From: Yi Qi Qing Re Gao formula ameliorates puromycin aminonucleoside-induced nephrosis by suppressing inflammation and apoptosis

  Primer Sequence
TNF-α Forward GCCCAGACCCTCACACTC
Reverse TCCTGGTATGAAATGGCAAA
TNFR1 Forward TTTACAGCTTCGCAGAACCAC
Reverse CACACACTGGAAATGCGTCT
IL-1β Forward AGCAGCATCTCGACAAGAGC
Reverse ATCACACACTAGCAGGTCGTC
MCP-1 Forward CTGCTGCTACTCATTCACT
Reverse CCATTCCTTATTGGGGTCA
Caspase-3 Forward AGCAGTTACAAAATGGATTAC
  Reverse ATCTCCATGACTTAGAATCAC
Bcl-2 Forward TGAGTACCTGAACCGGCATC
  Reverse AGAAATCAAACAGAGGTCGCAT
β-actin Forward ACCCTAAGGCCAACCGTGAAAAG
Reverse CATGAGGTAGTCTGTCAGGT