Skip to main content

Advertisement

Table 2 Validated genes and their primer sequences by real-time RT-PCR

From: Study of ZHENG differentiation in Hepatitis B-caused cirrhosis: a transcriptional profiling analysis

Gene symbol Genebank Forward primer Reverse primer
PNP (purine nucleoside phosphorylase) NM_000270 GAGCCCGTGCCCTACCACAC GCAGAACTGAGCCCCTCGGAA
AQP7 (aquaporin 7) NM_001170 TGAGAAGCCCCCAAGGCGGA GCCTGTGCCCGGATGCTTGA
PSMD2 (proteasome 26S subunit, non-ATPase 2) NM_002808 TGCGGCCATTGCCAGTGTCT GTTCCCCGTGGGCCAACAACA
ACTB (β-actin) NM_001101.3 ACAGAGCCTCGCCTTTGCCG ACATGCCGGAGCCGTTGTCG