Skip to main content

Advertisement

Table 1 Real time PCR primer sequence

From: Effects of β-sitosterol derived from Artemisia capillaris on the activated human hepatic stellate cells and dimethylnitrosamine-induced mouse liver fibrosis

Gene Forward primer (5' → 3') Reverse primer (5' → 3')
Human GAPDH CATGGCCTTCCGTGTTCCTA GCGGCACGTCAGATCCA
  COL1A1 GAGACTGTTCTGTTCCTTGTGTAACTG CCCGGTGACACATCAAGACA
  ACTA2 TGCCTGATGGGCAAGTGA CTGGGCAGCGGAAACG
  MMP1 GATCATCGGGACAACTCTCCT TCCGGGTAGAAGGGATTTGTG
  MMP2 TGAGCTATGGACCTTGGGAGAA CCATCGGCGTTCCCATAC
  GFAP CCGCAGCCCTGAAAGAGA TTGCTGGACGCCATTGC
Mouse Gapdh GCCACATCGCTCAGACACC CCCAATACGACCAAATCCGT
  Col1a1 CGATGGCGTGCTATGCAA ACTCGCCCTCCCGTTTTT
  Acta2 CCATGTACCCAGGCATTGCT GGGAGCGAGGGCTGTGAT
  1. Abbreviations: GAPDH human glyceraldehyde 3-phosphate dehydrogenase gene, COL1A1 human collagen type-1 alpha-1 gene, ACTA2 human alpha-smooth muscle actin gene, MMP1 human matrix metalloproteinase-1 gene, MMP2 human matrix metalloproteinase-2 gene, GFAP human glial fibrillary acidic protein gene, Gapdh mouse glyceraldehyde 3-phosphate dehydrogenase gene, Col1a1 mouse collagen type-1 alpha-1 gene, Acta2 mouse alpha-smooth muscle actin gene.