Skip to main content

Advertisement

Table 1 Genes used in GeXP multiplex analysis

From: Induction of cell cycle arrest and apoptosis in caspase-3 deficient MCF-7 cells by Dillenia suffruticosa root extract via multiple signalling pathways

Name Accession number Left sequence w/Universals Right sequence w/Universals
JNK NM_139046 AGGTGACACTATAGAATA CAGAAGCTCCACCACCAAAGAT GTACGACTCACTATAGGG AGCCATTGATCACTGCTGCAC
18SRNA a M10098 AGGTGACACTATAGAATA GGAGTGGAGCCTGCGGCTTAA GTACGACTCACTATAGGG ATAGCATGCCAGAGTCTCGTT
ERK1/2 NM_002745 AGGTGACACTATAGAATA GGAGCAGTATTACGACCCGA GTACGACTCACTATAGGG AGATGTCTGAGCACGTCCAGT
AKT1 NM_001014431 AGGTGACACTATAGAATA GAGGAGATGGACTTCCGGTC GTACGACTCACTATAGGG AAGGATCTTCATGGCGTAGTAGC
NF-κB NM_001077493 AGGTGACACTATAGAATA GCGGGCGTCTAAAATTCTG GTACGACTCACTATAGGG ATTCCACGATCACCAGGTAGG
ACTB a NM_001101 AGGTGACACTATAGAATA GATCATTGCTCCTCCTGAGC GTACGACTCACTATAGGG AAAAGCCATGCCAATCTCATC
GAPDH a NM_002046 AGGTGACACTATAGAATA AAGGTGAAGGTCGGAGTCAA GTACGACTCACTATAGGG AGATCTCGCTCCTGGAAGATG
p38MAPK NM_001315 AGGTGACACTATAGAATA TTCAGTCTTTGACTCAGATGCC GTACGACTCACTATAGGG AGTCAGGCTTTTCCACTCATCT
Kan(r) b   AGGTGACACTATAGAATA ATCATCAGCATTGCATTCGATTCCTGTTTG GTACGACTCACTATAGGG AATTCCGACTCGTCCAACATC
SOD1 NM_000454 AGGTGACACTATAGAATA TCATCAATTTCGAGCAGAAGG GTACGACTCACTATAGGG ATGCTTTTTCATGGACCACC
SOD2 NM_000636 AGGTGACACTATAGAATA CATCAAACGTGACTTTGGTTC GTACGACTCACTATAGGG ACTCAGCATAACGATCGTGGTT
CAT NM_001752 AGGTGACACTATAGAATA GAAGTGCGGAGATTCAACACT GTACGACTCACTATAGGG AACACGGATGAACGCTAAGCT
  1. aGene used for normalization; bInternal control gene.