Skip to main content

Advertisement

Table 1 Olgonucleotide sequences for Q-PCR

From: Berberine moderates glucose metabolism through the GnRH-GLP-1 and MAPK pathways in the intestine

Gene symbol Forward primer Reverse primer
Glp1r CATCGTGGTATCCAAACTGA GCTCGTCCATCACAAAGG
Gnrh1 TGGTATCCCTTTGGCTTTCA TCCTCCTCCTTGCCCATCTC
Gnrhr TTGTTGATGGCTGAGCAGTGA AAGCCCGTCCTTGGAGGAAAT
Mapk10 TCGAGACCGTTTCAGTCCAT CCACGGACCAAATATCCACT
Gadph GACCCCTTCATTGACCTCAAC CGCTCCTGGAAGATGGTGATG
  1. Glp1r: glucagon-like peptide 1 receptor; Gnrh1: gonadotropin releasing hormone 1; Gnrhr: gonadotropin releasing hormone receptor; Mapk10: mitogen activated protein kinase 10.