Skip to main content

Advertisement

Table 1 Primer sequences of target genes for qRT-PCR

From: The protective effects and genetic pathways of thorn grape seeds oil against high glucose-induced apoptosis in pancreatic β-cells

Target genes   Nucleotide sequences (5′-3′) Product size
GAPDH Forward AGCCCCCAACACTGAGCAT 111 bp
Reverse TGCAGCGAACTTTATTGATGGT
Caspase-3 Forward TTCTCCCTGGACGCCACTT 111 bp
Reverse CCTACCCCACTCCCAGTCATT
iNOS Forward GTCTCTCCAAACCCCTCACTGT 112 bp
Reverse GGAGCAAAAAAGGGCAACAC
Bcl-2 Forward TGGGATGCCTTTGTGGAACT 125 bp
Reverse CAGGTATGCACCCAGAGTGATG
Bax Forward GAGCTGCAGAGGATGATTGCT 128 bp
Reverse GCAAAGTAGAAGAGGGCAACCA
Fas Forward GTGTGCAAGGCTCAAGGATGT 120 bp
Reverse TGGGATGCCTTTGTGGAACT
ATF-3 Forward TCTAGCCGCTCTCTGGACC 147 bp
Reverse TCCTCAAACACCAGTGACCC
JNK Forward TCCAGTTCTCGTACCCGCTA 135 bp
Reverse AGCATGGCGTGACACAGTAA
p38 Forward TTTGCTCAGTACCACGACCC 107 bp
Reverse TCGTAGGTCAGGCTCTTCCA
Akt Forward GCTGCGGCTCCTCATTCA 125 bp
  Reverse CGCCGAGCTGGGAGTAAA