Skip to main content

Advertisement

Table 1 Primers used for RT-PCR

From: Abalone visceral extract inhibit tumor growth and metastasis by modulating Cox-2 levels and CD8+ T cell activity

Genes Sense Antisense
HPRT TTATGGACAGGACTGAAAGAC GCTTTAATGTAATCCAGCAGGT
Cox-2 TGAGCAACTATTCCAAACCAGC GCACGTAGTCTTCGATCACTATC
VEGF GCACATAGAGAGAATGAGCTTCC CTCCGCTCTGAACAAGGCT
FGF ACCCACACGTCAAACTACAAC CACTCCCTTGATAGACACAACTC
EGF TTCTCACAAGGAAAGAGCATCTC CTGCTGTCCCGTTAAGGAAAAC
MMP13 CTTCTTCTTGTTGAGCTGGACTC CTGTGGAGGTCACTGTAGACT
GzmB CCACTCTCGACCCTACATGG GGCCCCCAAAGTGACATTTATT
GzmC GCAGAGGAGATAATCGGAGGC GCACGAATTTGTCTCGAACCA
FasL TCCGTGAGTTCACCAACCAAA GGGGGTTCCCTGTTAAATGGG
TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC
IFN-γ GAGCCAGATTATCTCTTTCTACC GTTGTTGACCTCAAACTTGG