Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells

  • Wan Nuraini Wan Hasan1,

    Affiliated with

    • Mi-Kyoung Kwak2,

      Affiliated with

      • Suzana Makpol1,

        Affiliated with

        • Wan Zurinah Wan Ngah1 and

          Affiliated with

          • Yasmin Anum Mohd Yusof1Email author

            Affiliated with

            BMC Complementary and Alternative MedicineThe official journal of the International Society for Complementary Medicine Research (ISCMR)201414:72

            DOI: 10.1186/1472-6882-14-72

            Received: 3 February 2013

            Accepted: 11 February 2014

            Published: 23 February 2014

            Abstract

            Background

            Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice.

            Methods

            WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [NAD(P)H: quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)].

            Results

            Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells.

            Conclusion

            The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the exception of SOD1 which may not be dependent on this pathway.

            Keywords

            Nrf2 PB ARE NQO1 HO-1 GST. SOD1

            Background

            Piper betle L. (PB) from Piperaceae family grows well in South East Asia. The leaves of PB are used as masticatory in many Asian countries including Malaysia. Eugenol and hydroxychavicol are two bioactive compounds in PB that have been reported to have antioxidant and anti-inflammatory properties [1, 2]. The highest phytochemical present in water extract of PB leaves is hydroxychavicol which contributed to its antioxidant activity [2]. PB improved antioxidant status by increasing activities of free radical–detoxifying enzymes such as superoxide dismutase, catalase, and glutathione peroxidase during aging in erythrocyte of C57BL/6 mice [3] and increased the levels of nonenzymatic antioxidants such as reduced glutathione in liver and kidney of ethanol-treated rats [4]. Aqueous extract of PB leaves improved antioxidant potential by increasing SOD and catalase activity and also reducing lipid peroxidation in liver and kidney of diabetic-induced Wistar rats [5]. A recent finding showed that PB inhibited proliferation of breast cancer cell lines, MCF-7 and increased antioxidant activities such as SOD1 and CAT [6].

            Oxidative stress results from an imbalance between excess production of ROS and limited cellular antioxidant defense [7]. The basic leucine-zipper transcription factor nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) plays a vital role in protecting cells from oxidative stress [8, 9]. Nrf2 is normally sequestered in the cytoplasm as an inactive complex by interaction with its repressor Keap1 [10]. There are two prevailing models which proposed how Nrf2 is released from Keap1 in response to oxidative stress; (1) the ‘hinge and latch’ model, in which Keap1 modifications in thiol residues of Keap1 disrupt the interaction with Nrf2 causing misalignment of the lysine residues within Nrf2 that can no longer be polyubiquitinylated, and (2) the model in which thiol modification causes dissociation of Cul3 from Keap1 [11]. In both models, the inducer-modified and Nrf2-bound Keap1 is inactivated and, consequently, newly synthesized Nrf2 proteins bypass Keap1 and translocate into nucleus, bind to the Antioxidant Response Element (ARE) and leads to transcriptional induction of Nrf2 target genes such as heme oxygenase-1 (HO-1), superoxide dismutase (SOD1), catalase (CAT), NAD(P)H quinone oxidoreductase (NQO1), glutathione S-transferase (GST), and including glutathione biosynthesis enzymes glutathione cysteine ligase modifier subunit (GCLM) and glutathione cysteine ligase catalytic subunit (GCLC) [1118].

            Some phytochemical compounds that have been reported to activate the Nrf2/ARE pathway include sulforaphane from broccoli [19, 20], quercetin from onions [21] and epigallocatechin-3-gallate from green tea [20]. To our knowledge no information is available on the association of PB with the Nrf2/ARE signalling pathway. The aim of this experiment was to evaluate whether PB can modulate Nrf2/ARE pathway with subsequent increase in phase 2 and endogenous antioxidant enzymes using mouse embryonic fibroblast (MEF) from wild-type and Nrf2 knockout mice.

            Methods

            Materials

            Mouse embryonic fibroblasts (MEFs) were a kind gift from Kwak Mi-kyoung (The Catholic University of Korea, Bucheon, South Korea) and Nobunao Wakabayashi (University of Pittsburgh, USA).who have prepared the cell line from wild type (Nrf2+/+) and nrf2-disrupted (Nrf2-/-) ICR mice [22]. Reporter plasmid containing NQO1 ARE-luciferase [23] was also a kind gift from Kwak Mi-kyoung.

            Cell culture

            MEFs cells were cultured in Iscove’s modified Dulbecco’s medium (Invitrogen, USA) supplemented with 10% FBS (PAA, USA), 10 unit/ml penicillin-streptomycin and 2.5 μg amphoterecin-B (PAA, USA).

            MTS assay

            Cells were plated at a density of 5 × 103 cells/well in 96-well plates. After 24 h of incubation the cells were treated with various concentrations of aqueous PB extract. Then, 20 μl MTS solution (Promega, USA) was added to each well and the cells were further incubated for 4 h. The absorbance was measured at 490 nm using a Versamax microplate reader (Sunnyvale, CA, USA).

            Aqueous extraction of Piper betle leaves

            Dried PB leaves were purchased from Ethno Resources Company (Sungai Buloh, Selangor, Malaysia) and confirmation of identification of the plant was obtained from Herbarium, Universiti Kebangsaan Malaysia, Bangi with voucher number UKMB 29768. Aqueous extraction of PB was prepared according to Pin et al. [2] with some modifications. Briefly, the leaves were ground into powder and concentration of 10% PB was prepared and the extraction process was done using a Soxhlet Extractor (Eyela, Japan). The PB aqueous extract was freeze dried (Labconco, USA). into powder form and stored at 4°C until further use.

            Reporter plasmid transfection and luciferase activity measurement

            Cells were transfected with plasmids at 50% confluence using Welfect-Ex Plus transfection reagent (WelGene, Daegu, South Korea). Briefly, cells were incubated with the transfection complex containing 0.5 μg ARE-luciferase plasmid, 0.05 μg pRLtk control plasmid, and the transfection reagent (2 μg Welfect-Ex and 1.5 μg Enhancer-Q) in serum-and antibiotic-free OptiMEM (Invitrogen, USA). Transfection was continued for 18 h; the cells were then recovered in complete medium for the next 8 h. The cells were treated with 5 and 10 μg/ml of PB for 24 h and were then lysed with lysis buffer [RIPA buffer (Sigma, USA) and protease inhibitor cocktail tablet (Roche, Switzerland)]. Luciferase activities from firefly and Renilla luciferases in total cell lysates were determined using a Dual-Luciferase Assay kit (Promega, Wisconsin, USA) with a 20/20n luminometer (Turner Biosystems, Sunnyvale, CA, USA). Wild-type cells were treated with 5 μM sulforaphane (SFN) for 6 h as a positive control.

            Preparation of nuclear extracts

            For Nrf2 detection in the nucleus, cells were grown with a density of 6×105 and were treated with 5 and 10 μg/ml of PB for 10 and 12 h. After treatment, the cells were washed with cold-PBS. Crude nuclear fractions were obtained by lysing cells in homogenization buffer [2 M sucrose, 1 M Hepes, 2 M MgCl2, 2 M KCl, 30% glycerol, 0.5 M EDTA, 1 M dithiothreitol, protease inhibitor cocktail (Sigma, USA), and 0.2% NP-40 (Sigma, USA)], scraped off, vortexed for 30 min at 4°C and followed by centrifugation at 12,000 × g for 15 min. Protein concentration was determined using Bio-Rad protein assay dye (Hercules, CA).

            RNA extraction and quantitative real-time PCR

            Cells were seeded in 6-well plates at 2x105/well and cultured for 24-h. After 24-h treatment with 5 and 10 μg/ml of PB extract, the cells were washed with PBS and RNA was isolated using TRI reagent (Molecular Research Centre, Inc., USA). PCR amplification was performed with a thermal cycler (BioRad, USA). The mRNA level was quantified by Bio-Rad iCycler and the condition for PCR amplification was 40 cycles of 10 sec at 95°C for denaturation and 30 sec at 56°C for annealing. The primers sequences for the genes are listed in Table 1 and were synthesized by FirstBase (Singapore).
            Table 1

            Oligonucleotide sequences for real-time PCR of murine phase 2 and antioxidative enzymes

            Gene

             

            Sequences (5’-3’)

            Accession No

            β-actin

            Forward

            GAAGAGCTATGAGCTGCCTGA

            NM_007393.3

            Reverse

            GCACTGTGTTGGCATAGAGGT

             

            Nrf2

            Forward

            GAACTGTAGGAAAAGGAAGC

            U20532

            Reverse

            GAGTATTCACTGGGAGAGTA

             

            NQO1

            Forward

            TTCTCTGGCCGATTCAGAGT

            X13356

            Reverse

            GGCTGCTTGGAGCAAAATAG

             

            SOD1

            Forward

            CGGATGAAGAGAGGCATGTT

            Z18857

            Reverse

            CACCTTTGCCCAAGTCATCT

             

            GSTA1

            Forward

            CCGTTACTTGCCTGCCTTTG

            NM_145740

            Reverse

            CTTCTTCACATTGGGGAGGCT

             

            Western blot analysis

            Cells were incubated with 5 and 10 μg/ml of PB for 24 h for detection of NQO1, HO-1 and SOD1 protein expression. Briefly, 2×104 of cells were cultured in 60 mm petri dish and after 24 h treatment, the cells were lysed by using lysis buffer [RIPA buffer (Sigma, USA) and protease inhibitor cocktail tablet (Roche, Switzerland)] to extract the protein from cytosol. Finally, the cell lysates were centrifuged at 16,100 × g for 30 min and supernatant was stored at -80°C. Both cell lysates from cytosolic and nuclear extract were loaded on 12 or 15% SDS–polyacrylamide gels and separated by electrophoresis at 70 V using Mini-PROTEAN 3 cell system (BioRad, USA). Proteins on gels were transferred to PVDF membranes (Amersham Biosciences, UK) and the membranes were blocked with 5% skim milk in TPBS buffer (8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4, 0.24 g/L KH2PO4, and 2 ml/L Tween 20) for 1 h. Antibodies against β-actin, lamin B, SOD1 and NQO1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) while antibodies against HO-1 and HO-1 were purchased from Abcam, (Cambridge, UK). Primary antibody incubation was performed overnight followed by incubation with secondary antibody conjugated to horseradish peroxidase (SantaCruz, USA) for 1 h. Detection of proteins was performed using the Enhanced Chemiluminescence reagent (Amersham Biosciences, UK).

            Statistical analysis

            Statistical analysis was conducted using the SPSS software for Windows, version 16.0. Differences between mean values of multiple groups were analyzed by one-way analysis of variance (ANOVA) with Tukey’s HSD post-hoc test. Confidence level at the 95% (P < 0.05) was considered statistically significant.

            Results

            Viability of WT and N0 cells to PB treatment

            MTS assay was performed to measure cell viability after 24 h treatment with increasing doses of PB. N0 cells displayed almost 2-fold increased sensitivity (IC50) to PB compared to WT cells (Figure 1). This result indicated that N0 cells are more susceptible to cytotoxicity of PB treatment compared to WT cells.
            http://static-content.springer.com/image/art%3A10.1186%2F1472-6882-14-72/MediaObjects/12906_2013_1667_Fig1_HTML.jpg
            Figure 1

            N0 cells display increased toxicity to PB aqueous extract. WT and N0 cells were treated with increasing doses of PB for 24 h and cell viability was assessed by the MTS assay. Mean cell viability are expressed as percentage of control. Data represent ± S.E.M from three independent experiments. a P < 0.05, compared to control; b P < 0.05, compared to WT cells at the same concentration.

            Translocation of Nrf2 to nucleus by PB

            To verify dissociation of Nrf2 from Keap1, we measured the translocation of Nrf2 protein into the nucleus in both WT and N0 cells after 10 and 12 h treatment with PB. After 10 h of 10 μg/ml PB treatment, nuclear Nrf2 level in WT cells was significantly different (p < 0.05) compared to N0 cells while treatment for 12 h resulted in no significant changes of Nrf2 proteins between the two types of cells (Figure 2). When compared to with the positive control of 5 μM sulforaphane on WT for 6 h, PB treatment for 10 h activated Nrf2 and translocated it into the nucleus at a lower level compared to SFN. This suggested that PB activated Nrf2 protein which subsequently translocated from the cytosol to the nucleus better after 10 h treatment when compared to 12 h treatment.
            http://static-content.springer.com/image/art%3A10.1186%2F1472-6882-14-72/MediaObjects/12906_2013_1667_Fig2_HTML.jpg
            Figure 2

            Western blot analysis of nuclear translocation of Nrf2 by PB in Mouse Embryonic Fibroblast (MEF) of wild type (WT) and Nrf2 knockout cells (N0) for 10 and 12 h treatment. The blots shown are examples of three separate experiments (A) of Nrf2 protein in the nucleus after 10 and 12 h. SFN treatment for 6 h serve as the positive control for Nrf2 activation and translocation into the nucleus. MEF cells were treated with PB (5 and 10 μg/ml) for (B) 10 h (C) 12 h, after which the cells were gathered and Nrf2 protein was extracted from the nucleus. Lamin B was used as internal control. Data represent ± S.E.M from three independent experiments. a P < 0.05, compared to control WT cells; b P < 0.05, compared to respective WT cells group.

            ARE-luciferase reporter gene activity

            The inducer effect of PB on antioxidant and phase 2 genes mediated via ARE was verified as shown in Figure 3. Both WT and N0 cells were transfected with luciferase reporter plasmid containing the NQO1-ARE. Treatment of WT cells transfected with NQO1-ARE at 10 μg/ml of PB for 24-h showed 1.6-fold increase in luciferase activity compared to control (Figure 3).
            http://static-content.springer.com/image/art%3A10.1186%2F1472-6882-14-72/MediaObjects/12906_2013_1667_Fig3_HTML.jpg
            Figure 3

            ARE-driven luciferase activities after treatment with PB in MEFs WT and N0 cells. The cells were transfected with the luciferase reporter plasmid containing the NQO1 ARE and were treated with PB (5 and 10 μg/ml) or SFN (5 μM) for 24 h. Measurement of luciferase activities was performed using the Dual luciferase activities and Firefly luciferase levels were normalized to Renilla luciferase levels. Data represent ± S.E.M from four independent experiments. a P < 0.05, compared to control WT cells; b P < 0.05, compared to respective WT cells group.

            Effects of PB on gene expressions of antioxidants, phase I and phase II detoxifying enzymes

            To explore the effect of PB on Nrf2-genes, WT and N0 cells were treated with PB and transcript levels for Nrf2, NQO1, SOD and GSTA1 genes were assayed via real time PCR. At the baseline, Nrf2, NQO1 and GSTA1 genes were highly expressed in WT cells compared to N0 cells (Figure 4). Treatment with PB at 10 μg/ml for 24-h for both type of cells significantly increased Nrf2, NQO1 and GSTA1 genes expression in WT, but not in N0 cells. SOD1 gene expression was significantly greater in N0 cells compared to WT cells at the baseline. However, when the cells were treated with PB, there was no significant difference in SOD1 expression between WT and N0 cells.
            http://static-content.springer.com/image/art%3A10.1186%2F1472-6882-14-72/MediaObjects/12906_2013_1667_Fig4_HTML.jpg
            Figure 4

            Transcript levels for Nrf2, NQO1 and SOD1 genes following 5 and 10 μg/ml of PB treatment for 24-h. RNAs were isolated and reverse transcribed to cDNA, then amplified by real-time PCR detection system to measure mRNA levels for beta actin, Nrf2 (A), NQO1 (B) and SOD1 (C), HO-1 (D) and GSTA1 (E). Target genes were normalized to beta actin. Data represent ± S.E.M from three independent experiments. a P < 0.05, compared to control WT cells; b P < 0.05, compared to respective WT cells group.

            Effects of PB on NQO1 and HO1 protein expressions

            To verify the induction of PB on Nrf2-regulated proteins, we measured the expression of NQO1 and HO-1 proteins by Western blot technique. At the basal level, NQO1 and HO-1 proteins were significantly expressed in WT cells compared to N0 cells (Figure 5A). When the cells were treated with 10 μg/ml PB for 24-h, NQO1 and HO-1 proteins were significantly increased in WT cells, but not in N0 cells. SOD1 protein however, was significantly expressed in N0 cells (Figure 5D) in accordance with the expression of SOD1 genes (Figure 4C) with PB treatment. However there was no significant difference in SOD1 expression between WT and N0 cells.
            http://static-content.springer.com/image/art%3A10.1186%2F1472-6882-14-72/MediaObjects/12906_2013_1667_Fig5_HTML.jpg
            Figure 5

            Western blot of NQO1, HO-1 and SOD1 proteins in WT and N0 cells treated with PB (5 and 10 μg/ml). The blots shown are examples of three separate experiments (A) from 20 μg cytosolic proteins and relative intensities over β-actin for NQO1 (B), HO-1 (C) and SOD1 (D) protein expression after 24 h treatment of PB. SFN treatment at 5 μM was used as positive control. Data represent ± S.E.M from three independent experiments. a P < 0.05, compared to control WT cells; b P < 0.05, compared to respective WT cells group.

            Discussion

            The underlying mechanism by which local plant Piper betle (PB) stimulates Nrf2 pathway has yet not been elucidated. Our results on NQO1-ARE luciferase activity, mRNA, phase I oxidoreductase and phase II detoxifying enzymes showed that PB induced Nrf2/ARE pathway.

            This study illustrated that Nrf2 deficiency in MEF cells (N0) resulted in increased cytotoxicity with PB treatment compared to WT cells. Hydroxychavicol which is found in PB was shown to exert antioxidant activity at low concentration but display pro-oxidant effect at concentration higher than 0.1 mM [24]. Similarly, Nrf2-/- MEF cells were shown to be more sensitive to SFN treatment, peroxides, anti-cancer drugs (Displatin) and compounds that generate free radical compared to Nrf2+/+ MEF cells [25].

            The Nrf2-Keap1-ARE signaling system is central to the induction of phase 2 genes by electrophiles and antioxidants [16, 17, 20, 21]. We showed that PB was able to activate Nrf2 and translocated into the nucleus, with increased expression of NQO1 and HO-1 genes and proteins. We postulate that the mechanism of interaction between PB and Nrf2-Keap1 complex may mimic the action of other Nrf2 inducers such as sulforaphane and Gingko biloba extract. Keap1 protein contains multiple cysteine residues and specifically C257, C273, C297 and C288 were shown to be the most reactive residues that can interact with phase 2 inducers including sulforaphane [10]. Upon exposure to inducers, the reactive cysteine residues form intermolecular disulfide bonds and change its conformation which leads to dissociation of Nrf2 from Keap1, translocating Nrf2 into the nucleus, and activating the expression of phase 2 genes [26]. Ginkgo biloba extract stimulated Nrf2, and translocated it into the nucleus with subsequent increase in phase 2 genes such as GCLC, GST and NQO1 through Keap1-Nrf2-ARE signaling pathway in Hepa1c1c7 and HepG2 cells [27]. The active compound in coffee, 5-O-caffeoylquinic acid (CGA) modulates Nrf2 nuclear translocation and ARE-dependent gene expression such as HO-1, Nrf2, GST, γGCL in HT29 cells [28].

            In this study, we showed that Nrf2 translocation is better at 10 h incubation of PB, and for ARE induction, genes and proteins expression, we incubated the cells with PB for 24 h, which is similar to other studies [27, 29]. Sulforaphane caused nuclear translocation of Nrf2 after 6 h treatment by Western blotting; however immunocytochemistry data revealed that translocation of Nrf2 in the nucleus was not seen in many cells at 6 h treatment compared to 24 h incubation that displayed high amount of Nrf2 in the nucleus of human keratinocytes cells [29].

            The antioxidant response elements (ARE) are a cis-acting enhancer sequence located in the 5’-flaking promoter region of antioxidant and detoxifying genes such as GST, HO-1, GCLC and NQO1 [3035]. The luciferase reporter assay further confirmed that PB induced ARE promoter region in the nucleus. Our results are supported by Shin et al. [16] who reported that sulforaphane, a well known Nrf2 activator, increased luciferase activity 3.5-fold in rat kidney epithelial NRK cells. Other dietary agents which activate ARE reporter gene with increased expression of Nrf2-targeted genes such as NQO1, HO-1 and GCLC include resveratrol and xanthohumol [36, 37]. Other antioxidant, curcumin activated glutathione S-transferase P1 (GSTP1) gene expression by activating the expression of the luciferase gene from a reporter construct carrying GSTP1-ARE [38].

            The increased expressions of Nrf2, NQO1 and GSTA1 genes in WT cells but not in N0 cells further validated our claim that PB is a Nrf2/ARE inducer. McWalter et al. [39] reported that transcription factor, Nrf2 was activated by broccoli seeds and isothiocyanates, with induction of NQO1, GST and GCLC genes and proteins in Nrf2+/+ but not in Nrf2-/- mice. Our results are supported by the finding of Yoon et al. [40] who found that sulforaphane increased NQO1 and HO-1 proteins in human proximal cells. Cho et al., [8] have shown that Nrf2 gene was upregulated at least 2-fold higher in Nrf2+/+ mice than in Nrf2-/- mice at basal level and also in hyperoxia-induced mice. The possibility of polyphenols in PB such as chavicol or euginol inducing Nrf2 was also reported by a study of Tsai et al., who showed that phenolic compounds from rosemary and carnosic acid induced transcription of Nrf2, ARE luciferase reporter activity and increased expression of NQO1 gene and protein in rat clone 9 cells [41]. Lycopene metabolite, apo-8’-lycopenal that can be found in rat liver and human plasma after consuming lycopene-containing food, induced nuclear translocation, Nrf2-ARE binding activity, HO-1 and NQO1 genes and proteins expression in human hepatoma cell lines, HepG2 [42]. The isothiocyanate, sulforaphane and the flavonoid, epigenin increased gene expression of phase II detoxifying enzyme such as glutathione S-transferase (GSTA1) and UDP-glucuronosyltransferase (UGT1A1) in human colon adenocarcinoma [43]. L-sulforaphane modulates Nrf2-regulated genes including GSH biosynthesis (GCLC), glutathione S-transfreases (GSTA1, GSTA2, GSTA3, GSTM1) and NQO1 in small intestine of Nrf2+/+ and Nrf2-/- mice [16].

            Our results showed decreased HO-1 mRNA expression after 24 h treatment with PB while its protein level was found to be increased. This finding is similar to a time-course study by Motterlini et al. [44] who showed that HO-1 mRNA expression in bovine aortic endothelial cells reached a maximum after 6 h treatment with 5 μM curcumin and declined after 24 h treatment.

            Contrary to many findings, we noted that SOD1 gene and protein were not expressed in WT but were significantly expressed in N0 cells. Others who found similar results reported that the basal level of some antioxidant enzymes may not be under the influence of Nrf2 gene [45, 46]. Kwak et al. [47] found that MnSOD gene was 1.31 fold higher in Nrf2-disrupted mice compared to wild-type mice at constitutive levels, suggesting that Nrf2 is an essential factor to modulate many, but not all, antioxidant and phase 2 enzymes. The disruption of Nrf2 gene in Nrf2-/- may alter the basal and inducible expression of some genes including SOD1.

            Conclusion

            In summary, our findings indicate that PB activated Nrf2/ARE pathway by dissociating Nrf2 from Keap1, translocating Nrf2 protein into the nucleus, inducing antioxidant response element (ARE), thereby increasing Nrf2-regulated genes (Nrf2, NQO1 and GSTA1) and proteins such as NQO1 and HO-1.

            Declarations

            Acknowledgements

            Our sincere gratitude to Nobunao Wakabayashi and Kwak Mi-Kyoung for providing us with MEFs cells (WT and N0) and plasmid Nqo1 ARE. This research project was funded by Universiti Kebangsaan Malaysia research grant (UKM-GUP-07-21-201) and Mobility Programme (Outbound).

            Authors’ Affiliations

            (1)
            Department of Biochemistry, Faculty of Medicine, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz
            (2)
            College of Pharmacy, The Catholic University of Korea

            References

            1. Sharma S, Khan IA, Ali I, Ali F, Kumar M, Kumar A, Johri RK, Abdullah ST, Bani S, Pandey A, Suri KA, Gupta BD, Satti NK, Dutt P, Qazi GN: Evaluation of the antimicrobial, antioxidant, and anti-inflammatory activities of hydroxychavicol for its potential use as an oral care agent. Antimicrob Agents Chemother 2009, 53:216–222.PubMed CentralPubMedView Article
            2. Pin KY, Luqman Chuah A, Abdull Rashih A, Mazura MP, Fadzureena J, Vimala S, Rasadah MA: Antioxidant and anti-inflammatory activities of extracts of betel leaves ( Piper betle ) from solvents with different polarities. J Trop For Sci 2010, 22:448–455.
            3. Aliahmat NA, Mohd Noor MR, Wan Yusof WJ, Makpol S, Wan Ngah WZ, Mohd Yusof YA: Antioxidant enzyme activity and malondialdehyde levels can be modulated by Piper betle , tocotrienol rich fraction and Chlorella vulgaris in aging C57BL/6 mice. Clinics 2012, 67:1447–1454.PubMed CentralPubMedView Article
            4. Saravanan R, Prakasam A, Ramesh B, Pugalendi KV: Influence of Piper betle on hepatic marker enzymes and tissue antioxidant status in ethanol-treated Wistar rats. J Med Food 2002,5(4):197–204.PubMedView Article
            5. Dasgupta N, De B: Antioxidant activity of Piper betle L. leaf extract in vitro. Food Chem 2004, 88:219–224.View Article
            6. Abrahim NN, Kanthimathi MS, Abdul-Aziz A: Piper betle shows antioxidant activities, inhibits MCF-7 cell proliferation and increases activities of catalase and superoxidae dismutase. BMC Complement Altern Med 2012, 12:220.PubMed CentralPubMedView Article
            7. Sies H: Oxidative stress: Oxidants and Antioxidants. Exp Physiol 1997, 82:291–295.PubMed
            8. Cho JM, Manandhar S, Lee HR, Park HM, Kwak MK: Role of the Nrf2-antioxidant system in cytotoxicity mediated by anticancer cisplatin: Implication to cancer cell resistance. Cancer Lett 2008, 260:96–108.PubMedView Article
            9. Cho HY, Reddy SP, DeBiase A, Yamamoto M, Kleeberger SR: Gene expression profiling of NRF2-mediated protection against oxidative injury. Free Radic Biol Med 2005, 38:325–343.PubMedView Article
            10. Dinkova-Kostova AT, Holtzclaw WD, Cole RN, Itoh K, Wakabayashi N, Katoh Y, Yamamoto M, Talalay P: Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc Natl Acad Sci U S A 2002, 99:908–11913.View Article
            11. Taguchi K, Motohashi H, Yamamoto M: Molecular mechanisms of the Keap1–Nrf2 pathway in stress response and cancer evolution. Genes Cells 2011, 16:123–140.PubMedView Article
            12. Rushmore TH, Pickett CB: Transcriptional regulation of the rat glutathione S-transferase Ya subunit gene: Characterization of xenobiotic-responsive element controlling inducible expression by phenolic antioxidants. J Biol Chem 1990, 265:14648–14653.PubMed
            13. Nioi P, McMohan M, Itoh K, Yamamoto M, Hayes JD: Identification of a novel Nrf2-regulated antioxidant response element (ARE) in mouse NAD(P)H:quinine oxidoreductase 1 gene: reassessment of the ARE consensus sequence. Biochem J 2003, 374:337–348.PubMed CentralPubMedView Article
            14. Tong KI, Padmanabhan B, Kobayashi A, Shang C, Hirotsu Y, Yokoyama S, Yamamoto M: Different electrostatic potential define ETGE and DLG motifs as hinge and latch in oxidative stress response. Mol Cell Biol 2007, 27:7511–7521.PubMed CentralPubMedView Article
            15. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel JD, Yamamoto M: Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 1999, 13:76–86.PubMed CentralPubMedView Article
            16. Thimmulappa RK, Mai KH, Srisuma S, Kensler TW, Yamamoto M, Biswal S: Identification of Nrf2-regulated genes induced by the chemopreventive agent sulforaphane by oligonucleotide microarray. Cancer Res 2002, 62:5196–5203.PubMed
            17. Kwak MK, Wakabayashi N, Itoh K, Motohashi H, Yamamoto M, Kensler TW: Modulation of gene expression by cancer chemopreventive ditiolethiones through the Keap1-Nrf2 pathway: Identification of novel gene clusters for cell survival. J Biol Chem 2003, 278:8135–8145.PubMedView Article
            18. Hu R, Xu C, Shen G, Jain MR, Khor TO, Gopalkrishnan A, Lin W, Reddy B, Chan JY, Tony Kong AN: Identification of Nrf2-regulated genes induced by chemopreventive isothiocyanate PEITC by oligonucleotide microarray. Life Sci 2006, 79:1944–1955.PubMedView Article
            19. Nair S, Barve A, Khor TO, Shen GX, Lin W, Chan JY, Cai L, Kong AN: Regulation of Nrf2- and AP1-mediated gene expression by epigallocathechin-3-gallate and sulforaphane in prostate of Nrf2-knockout or C57BL/6J mice and PC-3 AP-1 human prostate cancer cells. Acta Pharmacol Sin 2010, 31:1223–1240.PubMedView Article
            20. Shin D, Park HM, Jung KA, Choi HG, Kim JA, Kim DD, Kim SG, Kang KW, Ku SK, Kensler TW, Kwak MK: The NRF2–heme oxygenase-1 system modulates cyclosporin A-induced epithelial–mesenchymal transition and renal fibrosis. Free Radic Biol Med 2010, 48:1051–1063.PubMed CentralPubMedView Article
            21. Arredondo F, Echeverry C, Abin-Carriquiry JA, Blasina F, Antúnez K, Jones DP, Go YM, Liang YL, Dajas F: After cellular internalization, quercetin causes Nrf2 nuclear translocation, increases glutathione levels, and prevents neuronal death against an oxidative insult. Free Radic Biol Med 2010, 49:738–747.PubMedView Article
            22. Kwak MK, Wakabayashi N, Greenlaw JL, Yamamoto M, Kensler TW: Antioxidants enhance mammalian proteasome expression through the Keap1-Nrf2 signaling pathway. Mol Cel Biol 2003, 23:8786–8794.View Article
            23. Kwak M-K, Itoh K, Yamamoto M, Kensler TW: Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: Role of antioxidant response element-like sequences in the Nrf2 promoter. Mol Cell Biol 2002,22(9):2883–2892.PubMed CentralPubMedView Article
            24. Chang MC, Uang BJ, Wu HL, Lee JJ, Hahn LJ, Jeng JH: Inducing the cell cycle arrest and apoptosis of oral KB carcinoma cells by hydroxychavicol: roles of glutathione and reactive oxygen species. Br J Pharmacol 2002, 135:619–630.PubMed CentralPubMedView Article
            25. Higgins LG, Kelleher MO, Eggleston IM, Yamamoto M, Hayes JD: Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytoxic effects of electrophiles, peroxides and redox-cycling agents. Toxicol Appl Pharmacol 2009, 237:267–280.PubMedView Article
            26. Wakabayashi N, Dinkova-Kostova , Holtzclaw WD, Kang M-I, Kobayashi A, Yamamoto M, Kensler TW, Talalay P: Protection against electrophile and oxidant stress by induction of the phase 2 response: Fate of cysteines of the Keap1 sensor modified by inducers. PNAS 2004, 101:2040–2045.PubMed CentralPubMedView Article
            27. Liu XP, Goldring CEP, Copple IM, Wang HY, Wei W, Kitteringham NR, Park BK: Extract of Ginkgo biloba induces phase 2 genes through Keap1-Nrf2-ARE signaling pathway. Life Sci 2007, 80:1586–1591.PubMedView Article
            28. Boettler U, Sommerfeld Volz N, Pahlke G, Teller N, Somoza V, Lang R, Hofmann T, Marko D: Coffee constituents as modulator of Nrf2 nuclear translocation and ARE (EpRE)-dependent gene expression. J Nutr Biochem 2011, 22:426–440.PubMedView Article
            29. Wagner AE, Ernst I, Iori R, Desel C, Rimbach G: Sulforaphane but not ascorbigen, indole-3-carbinole and ascorbic acid activates the transcription factor Nrf2 and induces phase-2 and antioxidant enzymes in human keratinocytes in culture. Exp Dermatol 2009, 19:137–144.PubMedView Article
            30. Rushmore TH, King RG, Paulson KE, Pickett CB: Regulation of glutathione S-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds. Proc Natl Acad Sci U S A 1990, 87:3826–3830.PubMed CentralPubMedView Article
            31. Wasserman WW, Fahl WE: Functional antioxidant responsive elements. Proc Natl Acad Sci U S A 1997, 94:5361–5366.PubMed CentralPubMedView Article
            32. Prestera T, Talalay P, Alam J, Ahn YI, Lee PJ, Choi AM: Parallel induction of heme oxygenase-1 and chemoprotective phase 2 enzymes by electrophiles and antioxidants: regulation by upstream antioxidant-responsive elements (ARE). Mol Med 1995, 1:827–837.PubMed CentralPubMed
            33. Favreau LV, Pickett CB: Transcriptional regulation of the rat NAD(P)H:quinone reductase gene: identification of regulatory elements controlling basal level expression and inducible expression by planar aromatic compounds and phenolic antioxidants. J Biol Chem 1991, 266:4556–4561.PubMed
            34. Wild AC, Gipp JJ, Mulcahy RT: Overlapping antioxidant response element and PMA response element sequences mediate basal and b-naphthoflavone-induced expression of the human c-glutamylcysteine synthetase catalytic subunit gene. Biochem J 1998, 332:373–381.PubMed CentralPubMed
            35. Ikeda H, Serria MS, Kakizaki I, Hatayama I, Satoh K, Tsuchida S, Muramatsu M, Nishi S, Sakai M: Activation of mouse Pi-class glutathione S-transferase gene by Nrf2 (NF-E2-related factor 2) and androgen. Biochem J 2002, 364:563–570.PubMed CentralPubMedView Article
            36. Ungvari Z, Bagi Z, Feher A, Recchia FA, Sonntag WE, Pearson K, Cabo R, Csiszar A: Resveratrol confers endothelial protection via activation of the antioxidant transcription factor Nrf2. Am J Physiol Heart Circ Physiol 2010, 299:H18-H24.PubMed CentralPubMedView Article
            37. Lee IS, Lim J, Gal J, Kang JC, Kim HJ, Kang BY, Choi HJ: Anti-inflammatory activity of xanthohumol involves heme oxygenase-1 induction via NRF2-ARE signalling in mikroglial BV2 cells. Neurochem Int 2011, 58:153–160.PubMedView Article
            38. Nishinaka T, Ichijo Y, Ito M, Kimura M, Katsuyama M, Iwata K, Miura T, Terada T, Yabe-Nishimura C: Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element. Toxicol Lett 2007, 170:238–247.PubMedView Article
            39. McWalter GK, Higgins LG, McLellan LI, Henderson CJ, Song L, Thornalley PJ, Itoh K, Yamamoto M, Hayes JD: Transcription factor Nrf2 is essential for induction of NAD(P)H: quinone oxidoreductase 1, glutathione S-transferases and glutamate cysteine ligase by broccoli seeds and isothiocyanates. J Nutr 2004, 134:3499S-3506S.PubMed
            40. Yoon HY, Kang NI, Lee HK, Jang KY, Park JW, Park BH: Sulforaphane protects kidneys against ischemia-reperfusion injury through induction of the Nrf2-dependent phase 2 enzyme. Biochem Pharmacol 2008, 75:2214–2223.PubMedView Article
            41. Tsai CW, Lin CY, Wang YJ: Carnosic acid induces the NAD(P)H: quinone oxidoreductase 1 expression in rat clone 9 cells through p38/Nuclear factor Erythroid-2 relted factor 2 pathway. J Nutr 2011, 141:2119–2125.PubMedView Article
            42. Yang C-M, Huang S-M, Liu C-L, Hu M-L: Apo-8'-lycopenal Induces Expression of HO-1 and NQO-1 via the ERK/p38-Nrf2-ARE Pathway in Human HepG2 Cells. J Agric Food Chem 2012, 60:1576–1585.PubMedView Article
            43. Svehlikova V, Wang S, Jakubikova J, Williamson G, Mithen R, Bao Y: Interactions between sulforaphane and apigenin in the induction of UGT1A1 and GSTA1 in CaCo-2 cells. Carcinogenesis 2004,25(9):1629–1637.PubMedView Article
            44. Motterlini R, Foresti R, Bassi R, Green CJ: Curcumin, an antioxidant and anti-inflammatory agent, induces heme oxygenase-1 and protects endothelial cells against oxidative stress. Free Radic Biol Med 2000,28(8):1303–1312.PubMedView Article
            45. Reisman SA, Yeager RL, Yamamoto M, Klaassen CD: Increased Nrf2 activation in livers from Keap1-knockdown mice increases expression of cytoprotective genes that detoxify electrophiles more than those that detoxify reactive oxygen species. Toxicol Sci 2009, 108:35–47.PubMed CentralPubMedView Article
            46. Zhu H, Itoh K, Yamamoto M, Zweier JL, Li Y: Role of Nrf2 signaling in regulation of antioxidants and phase 2 enzymes in cardiac fibroblasts: Protection against reactive oxygen species and nitrogen species-induced cell injury. FEBS Lett 2005, 579:3029–3036.PubMedView Article
            47. Kwak MK, Itoh K, Yamamoto M, Sutter TR, Kensler TW: Role of transcription factor Nrf2 in the induction of hepatic phase 2 and antioxidative enzymes in vivo by the cancer chemopreventive agent, 3H-1,2-dithiole-3-thione. Mol Med 2001, 7:135–145.PubMed CentralPubMed
            48. Pre-publication history

              1. The pre-publication history for this paper can be accessed here: http://​www.​biomedcentral.​com/​1472-6882/​14/​72/​prepub

            Copyright

            © Wan Hasan et al.; licensee BioMed Central Ltd. 2014

            This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.